WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 


Клинико-микробиологические особенности акнеподобных дерматозов, осложненных демодекозом

На правах рукописи

ЕЛИСТРАТОВА

Людмила Леонтьевна

КЛИНИКО-МИКРОБИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ

АКНЕПОДОБНЫХ ДЕРМАТОЗОВ, ОСЛОЖНЕННЫХ

ДЕМОДЕКОЗОМ

03.02.03 – Микробиология

14.01.10 – Кожные и венерические болезни

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата медицинских наук

Санкт-Петербург

2013

Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Ульяновский государственный университет» Министерства здравоохранения Российской Федерации

Научный руководитель: Потатуркина-Нестерова Наталья Иосифовна

доктор медицинских наук профессор

Нестеров Алексей Сергеевич

доктор медицинских наук профессор

Официальные оппоненты: Сбойчаков Виктор Борисович

доктор медицинских наук, профессор

ФГКВОУ ВПО «Военно-медицинская

академия им. С.М. Кирова» МО РФ,

профессор

Заславский Денис Владимирович

доктор медицинских наук, профессор

ГБОУ ВПО «Санкт-Петербургский

государственный педиатрический

медицинский

университет» МЗ РФ, профессор

Ведущая организация: ГБОУ ВПО «Санкт-Петербургский

государственный медицинский

университет им. акад. И.П. Павлова»

Министерства здравоохранения

Российской Федерации

Защита диссертации состоится 28 марта 2013 г. в 13.00 часов на заседании совета по защите докторских и кандидатских диссертаций Д 215.002.08 при ФГКВОУ ВПО «Военно-медицинская академия имени С.М. Кирова» МО РФ (194044, Санкт-Петербург, ул. Акад. Лебедева, д. 6)

С диссертацией можно ознакомиться в фундаментальной библиотеке
Военно-медицинской академии им. С.М. Кирова.

Автореферат разослан «___» февраля 2013 г.

Ученый секретарь диссертационного совета

доктор медицинских наук профессор

Митин Юрий Алексеевич

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность исследования. Акнеподобные дерматозы, такие как розацеа, периоральный дерматит, розацеаподобный дерматит, себорейный дерматит и др., остаются одной из самых актуальных проблем дерматологии. Среди данных дерматозов наибольший удельный вес имеют розацеа – 36% и периоральный дерматит – 25% (Юцковская Я.А. и соавт, 2010).

Изучению этиологии и патогенеза хронических кожных заболеваний уделяется большое внимание во всем мире. Несмотря на наличие многочисленных работ отечественных и зарубежных исследователей, этиология данных заболеваний не известна, а механизмы формирования во многом не ясны. До настоящего времени нет единой точки зрения на причины хронизации акнеподобных дерматозов (Адаскевич В.П., 2003; Громова С.А., Олисова О.Ю., 2003; Ахтямов С.Н. и соавт, 2007).

В последние десятилетия активно обсуждается вопрос о важной роли клещей рода Demodex в развитии розацеа и периорального дерматита. При этом ряд исследователей считают присутствие данных паразитов в сально-волосяных фолликулах кожи лица основной причиной развития розацеа (Коган Б.Г., Головченко Д.Я. 2011). В то же время, имеются мнения, что демодекоз является самостоятельным заболеванием, однако в Международной классификации болезней Х пересмотра демодекоз не представлен как отдельная нозологическая форма, что отражает представление лишь о провоцирующем действии клеща в развитии акнеподобных дерматозов (Давыдова И.Б., Чхатвал Н.А., Королева М.А., 2008; Заслаский Д.В., 2009).

Можно предположить, что формирование акнеподобных дерматозов создает благоприятные условия для существования и размножения клеща, что утяжеляет клиническое течение заболеваний и субъективные ощущения пациента (Самцов А.В. и соавт, 2002). Именно Demodex является переносчиком микробов и вирусов в более глубокие слои дермы и усиливает в очагах поражения пустулизацию (Батыршина С.В. и соавт, 2005). Так, например, M. Norn с помощью электронного микроскопа обнаружил бактерии на поверхности тела Demodex folliculorum (Norn M.S., 1972).

Наличие пустул и положительный эффект от антибактериальной терапии позволяет предположить инфекционную природу акнеподобных дерматозов (Козловская В.В., 2010; Потекаев Н.Н. и соавт., 2000; Lehmann Р., 2005). Кроме того, имеются данные, что при розацеа за счет повышения температуры кожи создаются благоприятные условия для размножения патогенной микрофлоры (Dahl M.V. et al., 2004). Однако роль микроорганизмов в развитии акнеподобных дерматозов до сих пор мало изучена (Насыбуллина Н.М., 2006).

Степень разработанности темы исследования. Основанием для диссертации служат исследования в области акнеподобных дерматозов отечественных и зарубежных ученых (В.П. Адаскевич, Д.В. Заславский, Н.Н. Потекаев, А.В. Самцов, Е.В. Соколовский, K. Aroni, J.B. Bikowski, F. Forton и др. авторов). В работах изложены основные принципы этиопатогенеза розацеа и периорального дерматита, а также методы лечения.

Исследователями не в полной мере раскрыта роль клещей рода Demodex в этиопатогенезе розацеа и периорального дерматита, их частота встречаемости и влияние на клинические проявления дерматозов. Недостаточно раскрыты особенности микрофлоры пораженных участков кожи лица у больных акнеподобными дерматозами. Мало изучен видовой спектр и факторы вирулентности бактерий, выделенных из очагов поражения при розацеа и периоральном дерматите, осложненных демодекозом.





Цель исследования: охарактеризовать клинико-микробиологические особенности розацеа и периорального дерматита в зависимости от наличия микроскопических клещей рода Demodex.

Задачи исследования:

  1. Изучить частоту встречаемости микроклещей рода Demodex у больных розацеа и периоральным дерматитом.
  2. Выявить особенности клинических проявлений у пациентов с акнеподобными дерматозами, сочетанными с демодекозом.
  3. Дать характеристику микробиоценоза пораженных участков кожи лица у больных розацеа и периоральным дерматитом при наличии у них демодекоза.
  4. Определить видовой спектр и факторы вирулентности бактерий, выделенных из очагов поражения при акнеподобных дерматозах, осложненных демодекозом.
  5. Определить фенотипические проявления и частоту встречаемости генетических детерминант вирулентности клинических изолятов бактерий рода Staphylococcus, выделенных из микробных консорциумов очагов поражения при акнеподобных дерматозах, осложненных демодекозом.

Научная новизна. Установлена зависимость между тяжестью клинических проявлений акнеподобных дерматозов и выявляемостью у больных розацеа и периорального дерматита микроклещей рода Demodex.

Выявлены основные направления изменений микробных консорциумов, проявляющиеся в широком видовом спектре и достоверном увеличении показателей частоты встречаемости патогенных и условно-патогенных видов микроорганизмов при розацеа и периоральном дерматите.

Получены новые знания о микробиоценозе пораженных участков кожи при розацеа и периоральном дерматите, установлено преобладание представителей рода Staphylococcus, среди которых доминировали S. aureus и S. haemolyticus, обладающие достоверно большей вирулентностью.

Впервые у штаммов S. aureus и S. haemolyticus, обнаруженных у больных розацеа и периоральным дерматитом, осложненных демодекозом, выявлено достоверное увеличение генетических детерминант вирулентности, контролирующих продуцирование таких факторов вирулентности, как липаза, ДНК-аза, гемолизина-III и -гемолизина.

Теоретическая и практическая значимость. Материалы работы используются в диагностической и лечебной работе Ульяновского областного клинического кожно-венерологического диспансера и внедрены в учебно-педагогический процесс преподавания дерматовенерологии и микробиологии студентов медицинского и педиатрического факультетов ФГБОУ ВПО «Ульяновский государственный университет», а также слушателей клинической ординатуры и интернатуры факультета последипломного образования и научно-исследовательской лаборатории ФГБОУ ВПО «Ульяновский государственный университет». Изданы практические рекомендации для врачей, интернов и ординаторов, студентов медицинских вузов: «Особенности клинических проявлений акнеподобных дерматозов, осложненных демодекозом» (г. Ульяновск: УлГУ, 2012), «Микрофлора кожи при акнеподобных дерматозах» (г. Ульяновск: УлГУ, 2012).

Сочетании розацеа и периорального дерматита с демодекозом определяет необходимость в лабораторном исследовании, включающее паразитологическое, бактериологическое исследования, выявление факторов вирулентности для последующего назначения этиотропного лечения, а также профилактики осложнений.

Методология и методы исследования. Методологической основой диссертационной работы явилось последовательное применение методов научного познания. Работа выполнена в дизайне сравнительного открытого исследования с использованием клинических, инструментальных, лабораторных, аналитических и статистических методов.

Положения, выносимые на защиту:

  1. Микроскопические клещи рода Demodex встречаются у 88,7 % больных розацеа и 58,8 % периоральным дерматитом. При наличии демодекоза у больных акнеподобными дерматозами течение заболевания характеризуется большей выраженностью клинических симптомов и достоверным увеличением частоты рецидивов.
  2. Розацеа и периоральный дерматит, осложненные демодекозом, сопровождаются изменением микробиоценоза кожи, что проявляется достоверным расширением видового спектра и показателей частоты встречаемости патогенных и условно-патогенных видов микроорганизмов, а также достоверным увеличением у них количественных показателей генетических детерминант вирулентности.

Внедрение результатов исследования. Разработано и внедрено в практику комплексное микробиологическое обследование больных акнеподобными дерматозами, включающее изучение патогенного потенциала микрофлоры пораженных участков кожи для оценки их этиологической значимости и прогнозирования течения заболевания (Акт внедрения № 3 от 14.09.2012, выдан ГУЗ «Городская поликлиника №3» г. Ульяновска).

Личный вклад автора в проведенное исследование. Тема и план диссертации, ее основные идеи и содержание разработаны совместно с научным руководителем на основании целенаправленных исследований. Автор принимал непосредственное участие в клиническом обследовании больных и в лабораторных исследованиях. Лично проводил оценку клинического течения розацеа и периорального дерматита, а также результатов бактериологических и молекулярно-генетических исследований.

Автором подробно исследованы особенности микробиоценоза кожи у больных акнеподобными дерматозами на фоне демодекоза, изучена вирулентность выделенных штаммов стафилококков и ее генетические детерминанты, а также характер изменений показателей колонизационной резистентности клинических изолятов в зависимости от нозологической формы дерматоза и тяжести его течения.

Автором планировалось настоящее исследование, формировалась база данных и обобщение полученных результатов. Материал был проанализирован с помощью современных методов статистического

Диссертант самостоятельно провела экспериментальные микробиологические исследования, весь объем клинических и инструментальных исследований, обработку полученных результатов, сформировала базу данных, выполнил их статистический анализ и обобщение.

Апробация работы. Диссертация выполнена в соответствии с планом научной работы ФГБОУ ВПО «Ульяновский государственный университет».

Основные положения диссертационной работы доложены на симпозиуме Национального Альянса дерматологов и косметологов. (г. Ростов-на-Дону, 2008), на международном форуме медицины и красоты (Москва, 2008), Всероссийской конференции с международным участием «Медико-физиологические проблемы экологии человека» (г.Ульяновск, 2007); 43-й научно-практической межрегиональной конференции врачей «Год семьи. Механизмы реализации приоритетного национального проекта и демографической политики в системе здравоохранения» (г.Ульяновск, 2008), 44-й межрегиональной научно-практической медицинской конференции врачей (г.Ульяновск, 2009); 45-ой научно-практической межрегиональной конференции врачей (г.Ульяновск, 2010); Всероссийская научно-практическая конференция (школа-семинар) в рамках федеральной целевой программы (г.Тольятти, 2012).

Публикации. По материалам диссертации опубликовано 13 печатных работ, в том числе 5 статей в рецензируемых журналах из списка изданий, рекомендованных ВАК Минобразования России.

Структура и объем диссертации. Диссертационная работа изложена на 139 страницах машинописного текста и состоит из введения, обзора литературы, описания материалов и методов исследований, результатов исследований, обсуждения полученных результатов, выводов и списка использованной литературы, содержащего 129 отечественных и 61 иностранных источников. Текст иллюстрирован 28 таблицами и 45 рисунками.

СОДЕРЖАНИЕ РАБОТЫ

Характеристика материалов и методов исследования

Клинические исследования выполнены в период с 2009 по 2011 гг. на базе ГУЗ ОККВД г. Ульяновска. У всех больных акнеподобными дерматозами (n=427), средний возраст которых составил 34,2±0,82 лет, при скрининговом обследовании было проведено паразитологическое исследование с целью выявления демодекоза. Обнаружено, что частота осложнений клещами рода Demodex follicolorum у обследованных составила 73,1% (n=312), из них среди больных розацеа – 88,7%, периоральным дерматитом – 58,8%.

Обследовано 122 пациента с клиническими проявлениями розацеа (71 пациент) и периорального дерматита (51 пациент). Продолжительность заболеваний составляла 3,9 ± 0,93 лет. В первую группу сравнения входили пациенты с клиническими проявлениями розацеа (68 больных) и периорального дерматита (47 больных) без демодекоза. Вторую группу сравнения составили 52 практически здоровых человека, репрезентативных по полу и возрасту.

Критерии включения в исследование: больные с достоверно установленным диагнозом розацеа и периорального дерматита; возраст больных старше 18 лет и не более 60 лет; информированное согласие пациента.

Из всех обследованных больных розацеа 73,3% (52 пациентов) составили женщины и 26,7% (19 человек) мужчины, средний возраст которых составил 36,7±0,89 лет. Продолжительность заболевания была 3,6±0,74лет. Среди больных розацеа эритематозная форма выявлена у 12 пациентов (16,9%), папулезная – у 27 (38,0%), пустулезная – у 31 (43,7%) и инфильтративно-продуктивной формой (гиперторофическая) – 1 (1,4%) пациент.

Больных периоральным дерматитом обследовано 51 человек, из них 43 (84,3%) женщины и 8 (15,7%) мужчин, средний возраст которых составил 31,2±0,78 лет. Продолжительность заболевания была равна 4,2 ± 0,82 лет.

Легкая форма заболевания наблюдалась у 9 (17,7%), средняя – 25 (49,0%), тяжелая – 17 (33,3%) пациентов.

Диагнозы устанавливали на основании клинической картины заболеваний, которую оценивали по основным и второстепенным диагностическим критериям (Wilkin J., Dahl M. et all., 2002; Dahl M., 2004, Lehmann P., 2005). В процессе исследования пациентов с розацеа применялась шкала диагностической оценки розацеа (ШДОР) (Адаскевич В.П., 2004), которая включала выраженность эритемы, количество папул и пустул, телеангиэктазии, сухость кожи, жжение и покалывание, отек лица, а также выраженность симптомов офтальморозацеа. Для оценки тяжести течения периорального дерматита использовали клинический балльный индекс количественного учета объективных симптомов (эритема, папулы, шелушение) периорального дерматита – ИТПОД (индекс тяжести периорального дерматита) (Wollenberg A., Oppel T., 2006).

Количественную и качественную оценку состава микрофлоры кожи производили бактериологическим методом в соответствии с Приказом МЗ СССР №535 от 22.04.85. «Об унификации микробиологических методов исследования, применяющихся в клинико-диагностических лабораториях».

Определение антибиотикорезистентности культур проводили диско-диффузным методом на агаре Мюллера-Хинтона (Hispanlab/Laboratorios Conda, Испания) (Методические указания 4.2.1890-04.2004). Для выявления чувствительности микроорганизмов к антибиотикам определяли минимальную ингибирующую концентрацию препарата – МИК в ЕД/мл или мкг/мл (Навашин С.М., Чучалин А.Г., Белоусов Ю.Б., 1998).

Вирулентность клинических изолятов выявляли внутрибрюшинной пробой на белых мышах и выражали через LD50 (Костюкова И.С. и соавт., 1996).

Молекулярно-генетические методы с применением полимеразной цепной реакции (ПЦР) использовали для определения генетических детерминант вирулентности Staphylococcus aureus и Staphylococcus haemolyticus (Маккреди Б.Д, Чимера Д.А., 1999) на базе клинико-диагностической лаборатории ГУЗ УОКБ «Областная клиническая больница №1». Для этого применяли реакционную смесь ПЦР-РВ в присутствии EVA-Green и набора праймеров (ООО «Синтол», г. Москва) (табл.1).

Таблица 1

Использованные в работе праймеры

Ген Фактор вирулентности Пары праймеров: прямой/обратный
Праймеры к участкам генов гемолизина-III и -гемолизина S. haemolyticus
1 участок гена гемолизина-III 5' GCACATGGAACGTTAAGCTCAG 3 ' 5' GGGCATAAAACCAAGCACCAA 3'
2 участок гена -гемолизина 5' CACCTATGACGCCACCTACA 3' 5' GCGACGAATTCCCATATAGCC 3'
Праймер к участкам генов липазы и дезоксирибонуклеазы S. aureus
3 участок гена липазы 5’ ATGAAGCACAAGCCTCGGAA 3' 5’ TCTGTCGGTTTCTCTGGGGA 3'
4 участок гена ДНК-азы 5’ TTGCTTGCGACAATCGCTAC 3' 5’ ACCACCCGTTTTATCGCTTGA 3'




Бактериальную ДНК выделяли из культур, выросших на питательных средах, методом аффинной сорбции. Тотальную ДНК для идентификации генов выделяли с использованием набора реагентов «Выделение ДНК из биопроб» (НПФ «Литех», Москва). Подбор праймеров и температуры отжига осуществляли при использовании пакета программ в Gene Runner Version 3.05 и Primer Blast (ресурсы GeneBank) (США). Праймеры стафилококков были синтезированы в «ООО Синтол» (Москва).

Амплификацию ДНК осуществляли на программируемом амплификаторе «Терцик» (ООО «НПФ ДНК-Технологии», г. Москва). Для проведения амплификации была использована коммерческая стандартная лиофилизированная реакционная смесь с оптимизированной для классической схемы ПЦР буферной системой (ООО «ИзоГен», г. Москва), «Набор реагентов для проведения ПЦР-РВ с Taq-ДНК-полимеразой и ингибирующими активность фермента антителами в присутствии красителя EVA-Green» (Компания «Синтол», г. Москва). Регистрацию результатов ПЦР осуществляли путем электрофоретического разделения продуктов амплификации на окрашенном бромистом этидием агарозном геле. Компьютерный анализ нуклетидных последовательностей проводили с помощью компьютерной программы Vector NTI Suite (США). Регистрацию флуоресцентного сигнала осуществляли с помощью оптической камеры прибора термоциклера, обрабатка производилась с помощью встроенного программного обеспечения (ДТ 322, ООО «НПФ ДНК-Технологии», г. Москва).

Статистическую обработку данных производили на компьютере с использованием пакетов программ для статистического анализа «Excel» и «Statistica 8.0». Критический уровень достоверности (р) нулевой статистической гипотезы (об отсутствии значимых различий) принимали равным 0,05.

Результаты исследований и их обсуждение

Определены показатели заболеваемости акнеподобными дерматозами у населения Ульяновской области в ходе статистической обработки отчетов за период 2009-2011гг. Они составили при розацеа – 4,33±1,61‰; ПД – 3,61±3,04‰; контактном акне – 2,04±2,02‰; климатическом акне – 1,49±2,54‰ и механическом акне – 0,26±0,46‰.

В связи с преобладанием в структуре акнеподобных дерматозов розацеа и периорального дерматита далее было проведено сравнительное изучение этих нозологических форм в зависимости от наличия у больных сопутствующего демодекоза.

На основании комплексного обследования пациентов выявлено, что у больных розацеа, осложненной демодекозом, чаще встречалась тяжелая форма заболевания (пустулезная), тогда как в группе сравнения преобладали более легкие (папулезная и эритематозная) (табл.2).

Клинически эритематозная форма розацеа характеризовалась приливной эритемой лица. У 41,6% пациентов эритема локализовалась на центральной части лица, у 16,7% – в области щек, у 16,7% – в носощечной области. У 25,0% пациентов эритема занимала обширные зоны с умеренной инфильтрацией. В группе сравнения у большинства больных (47,6%) элементы располагались в центральной части лица и только у 1 пациента (4,8%) эритема занимала обширные зоны. У всех пациентов на фоне эритемы наблюдалось наличие переплетающихся капиллярных телеагиэктазии ярко- или темно-красного цвета.

Таблица 2

Распределение больных по клиническим формам розацеа

Больные Формы розацеа Розацеа Группа сравнения
абс. % абс. %
Эритематозная 12 16,9 21 30,9
Папулезная 27 38,0 32 47,1
Пустулезная 31 43,7 15 22,0
Инфильтративно-продуктивная (гипертрофическая) 1 1,4 - -
Всего 71% 100% 68% 100%

У 27 пациентов (38,0%) отмечалась папулезная форма розацеа. У этих больных на фоне эритемы и пастозности кожи с обилием тонких и широких телеангиэктазий, наблюдались розово-красные папулы диаметром 3-5 мм, плотно-эластической консистенции, округлых очертаний, полусферической или несколько уплощенной формы, со слабо контурированными границами. У большинства пациентов (18 больных) папулы локализовались в нижней трети лица (щеки, край нижней челюсти, подбородок). У 33,3% пациентов высыпания располагались повсеместно (на лбу, щеках, подбородке), в отличии от группы сравнения, где такая локализация элементов была лишь у 9,4% больных. В основании наиболее крупных элементов отмечалась инфильтрация.

Пустулезная форма наблюдалась у 31 больного. Клинически она характеризовалась интенсивной эритемой в сочетании с отечностью и инфильтрацией. Отмечались папулезные и пустулезные высыпания величиной 1-5 мм в диаметре, полушаровидной формы с содержимым желтого или зеленовато-желтого цвета. У 25,8% пациентов элементы были сгруппированы, имели большие размеры (5-6 мм в диаметре) и инфильтрированное основание. Как правило, такие элементы располагались в нижней трети лица (край нижней челюсти, скуловая область и подбородок).

Инфильтративно-продуктивная (гиперторофическая) форма розацеа у обследованной группы наблюдалась у 1 пациента (в группе сравнения больные с данной формой не встречались). Инфильтративно-продуктивная (гиперторофическая) форма проявлялась в виде ринофимы. На фоне стойкой эритемы с багрово-синюшным оттенком отмечались стойко делатированные сосуды и устья расширенных сальных желез, локализующиеся, преимущественно, в области носа и щек.

Из всех пациентов обследуемой группы у 9,8% наблюдалась офтальморозацеа, которая сопровождалась блефаритом и конъюнктивитом. В группе сравнения данных осложнений не наблюдались.

Под наблюдением находилось 12 пациентов (16,9%) с легкой степенью тяжести, со средней степенью тяжести 35 (49,3%) и с тяжелой степенью тяжести было 24 пациента (33,8%). В группе сравнения основную долю пациентов составляли больные с легкими проявлениями дерматоза (табл.3).

Таблица 3

Характеристика тяжести течения розацеа, осложненной демодекозом

Тяжесть течения Основная группа Группа сравнения
абс. % абс. %
Легкая (1-7 баллов) 12 16,9% 39 57,4%
Средняя (8-14 баллов) 35 49,3% 21 30,9%
Тяжелая (15-21 баллов) 24 33,8% 8 11,7%
Всего 71% 100% 68% 100%

Особенности клинического течения розацеа на фоне демодекоза характеризовались увеличением частоты рецидивов два и более раза в год по сравнению с пациентами розацеа без демодекоза.

Из всех обследованных больных с розацеа, осложненной демодекозом, у 49 пациентов (69,1%) были жалобы на зуд различной интенсивности, ощущение сухости кожи (16,9%), жжения и покалывания (12,7%), а также отечность лица (9,9%). В группе сравнения субъективные проявления заболевания наблюдались реже - у 45,6% пациентов.

На основании комплексного обследования пациентов периоральным дерматитом выявлено, что у пациентов основной группы чаще встречалась средняя форма заболевания, тогда как в группе сравнения преобладала легкая (табл.4).

Таблица 4

Распределение больных по клиническим формам периорального дерматита

Больные Формы ПД ПД+Д ПД
абс. % абс. %
Легкая 9 17,3 29 61,7
Средняя 26 50,0 13 27,6
Тяжелая 17 32,7 5 10,7
Всего 51% 100% 47% 100%

У 9 пациентов (17,3%) отмечалось легкая форма периорального дерматита. Клинически она характеризовалась едва заметной эритемой с единичными папулами диаметром 1-2 мм и наличием участка видимо непораженной кожи шириной 3-5 мм вокруг красной каймы губ. У 3-х больных (33,3%) наблюдалось незначительное шелушение.

Течение заболевания средней тяжести наблюдалось у 26 пациентов (50%). У этих больных наблюдались эритематозные пятна с полушаровидными папулами и мелкопластинчатым шелушением. У 17 (65,4%) пациентов высыпания локализовались в области носогубных складок, у 6 (23,0%) – в области медиальной части бровей и переносицы и у 3 (11,6%) больных – процесс носил генерализованный характер (затрагивал носощечные складки, зону верхней губы, подбородка и область бровей).

Тяжелая форма болезни наблюдалась у 17 пациентов (32,7%). На фоне эритематосквамозных бляшек, покрытых жирными чешуйками наблюдались множественные полушаровидные и остроконечные папулы с пустулами в центре. У двух больных наблюдалась отечность лица.

При периоральном дерматите по данным, полученным при помощи ИТПОД (индекс тяжести периорального дерматита) пациентов с легкой формой периорального дерматита было 11,8%, со средней –60,8%, с тяжелой – 27,4% (рис.1).

Особенности клинического течения периорального дерматита на фоне демодекоза характеризовались увеличением количества больных с частотой рецидивов 2 и более раза в год.

Рис. 1. Распределение больных периоральным дерматитом в зависимости от тяжести течения (%)

Из всех обследованных периоральным дерматитом, осложненном демодекозом субъективные ощущения отмечали 62,8% пациента. 19 пациентов отмечали зуд (37,3%) и 13 больных отмечалось чувство жжения (25,5%). В группе сравнения данные проявления были выявлены лишь у 44,7%.

Микрофлора кожи, с одной стороны, является одним из защитных механизмов организма человека, а с другой – резервуаром возбудителей инфекций, поддерживающих воспалительный процесс. Изучение микрофлоры пораженных участков кожи лица больных розацеа и периоральным дерматитом выявило ее значительные изменения, наиболее выраженные при сочетании дерматозов с демодекозом.

Микробиоценоз кожи при акнеподобных дерматозах, осложненных демодекозом, характеризовался более широким спектром видового состава, чем у здоровых. Наибольшее видовое разнообразие отмечалось у бактерий рода Staphylococcus. Так, у стафилококков идентифицировали 7 видов, у стрептококков – 4 вида и у коринебактерий – 2 вида, в отличии от микрофлоры кожи больных розацеа и периоральным дерматитом, не осложненных демодекозом, когда было обнаружено 5 видов стафилококков, 1 вид стрептококков и 1 вид коринебактерий. Следует отметить высокую степень колонизации кожи в зонах высыпаний при всех нозологических формах дерматозов S. aureus, S. capitis, S. haemolyticus и E. faecalis по сравнению со здоровыми лицами (p<0,05).

Таблица 5

Колонизационная плотность микробиоты кожи лица у больных акнеподобными дерматозами (n=289)

Микроорганизмы Показатели обсемененности кожи (lg КОЕ/см2)
Розацеа ПД Здоровые
Р+Д Р ПД+Д ПД
S. aureus 1127,04±121,25*^ 701,15±91,45^ 792,73±19,84*^ 517,24±17,37*^ 51,92±3,49
S. capitis 116,2±19,32^ 78,16±14,84^ 110,82±21,28^ 76,1±17,94^ 49,9±3,21
S. epidermidis 356,02±36,23*^ 147,21±19,62^ 301,67±71,37^ 198,72±38,14^ 49,58±2,69
S. haemolyticus 527,40±27,13*^ 219,83±16,1^ 392,63±27,98*^ 112,72±18,43^ 43,6±1,75
S. hominis 292,14±37,93*^ 187,17±22,4^ 237,35±33,17*^ 127,19±29,47^ 47,94±2,31
S. saprophyticus 90,8±17,37^ 68,8±14,82 62,8±14,51 49,62±9,36 38,3±2,74
S. warneri 82,94±11,35 58,2±9,36 64,92±9,98 47,87±8,47 -
M. luteus 97,26±20,17 63,4±12,78 - - -
S. pyogenes 137,96±20,96*^ 68,45±11,49^ 125,38±17,63*^ 75,3±12,47^ 31,26±1,78
S. anhaemoliticus 62,34±9,62* 29,18±8,47 59,4±9,87 41,8±8,63 -
S. mitis 120,82±16,17* 75,83±12,39 119,87±17,13* 70,2±6,96 -
S. mutans 98,37±19,75 63,12±14,3 109,1±17,3* 64,83±9,91 -
E. faecalis 121,62±17,98*^  70,31±14,32^  118,48±17,62*^  71,86±12,84^  38,96±3,94
C. xerosis 41,35±2,87 49,98±1,34 51,24±4,37 43,12±2,3 45,9±4,37
C. haemolyticus 149,3±18,9* 98,37±7,28 - - -
A. calcoaceticus 82,98±12,8* 53,47±5,02 68,9±12,34 47,34±8,26 -
Candida spp. 734,2±18,2*^  627,34±17,78^  578,6±19,8*^  412,18±17,62^  43,6±4,9

Примечание: * - достоверность различий показателей с больными Р и ПД (р<0,05); ^ - достоверность различий показателей со здоровыми (р<0,05)

Микробиоценоз кожи у больных акнеподобными дерматозами, осложненными демодекозом расширился также за счет появления таких видов как S. warneri, S. anhaemoliticus, S. mitis, S. mutans, M. luteus, C. haemolyticus и A. calcoaceticus, которые не высевались у здоровых. Из всех групп микроорганизмов наибольшая плотность колонизации отмечена у S. aureus и S. haemolyticus (табл. 5).

При розацеа и периоральном дерматите набольшая частота встречаемости отмечена у бактерий рода Staphylococcus. Так, при легкой форме заболевания в основном выделялся S. epidermidis, при средней - S. haemolyticus и S. capitis, при тяжелой – S. aureus. Другие виды определялись значительно реже. При розацеа и периоральном дерматите наиболее значимые изменения микробиоты кожи лица выявлены при длительности заболеваний более одного года и наличии у пациентов демодекоза.

Были изучены биологические свойства Staphylococcus aureus и Staphylococcus haemolyticus, выделенных с поверхности кожи лица больных розацеа и периоральным дерматитом, осложненными демодекозом и пациентов с данными дерматозами без инвазии.

Клинические изоляты стафилококков обладали типичными морфологическими, тинкториальными, культуральными и биохимическими свойствами.

Проведенные исследования показали, что стафилококки, выделенные у больных акнеподобными дерматозами, протекающими на фоне демодекоза и без него, имели различную частоту встречаемости факторов вирулентности (табл. 6).

Таблица 6

Частота встречаемости факторов вирулентности клинических изолятов

S. aureus и S. haemolyticus (%)

Наименование теста Основная группа (n=122) Группа сравнения 1 (n=115) Группа сравнения 2 (n=52)
Каталаза 79,5±6,7*^ 54,8±8,9^ 3,8±0,4
Гемолизин 93,4±3,7*^ 58,13±8,8^ 1,9±0,1
Коагулаза 74,6±7,3 69,6±8,0 -
Липаза 85,2±5,8* 57,4±8,9 -
ДНК-аза 89,3±4,9* 53,0±9,1 -
Плазмакоагулаза 72,9±7,4*^ 45,2±9,1^ 1,9±0,1

Примечание: * – достоверность различий показателей между пациентами основной группы и группы сравнения 1 (р<0,05);

^ – достоверность различий показателей со здоровыми (р<0,05)

Как видно из таблицы, большей частотой встречаемости факторов вирулентности обладали S. aureus и S. haemolyticus, выделенные у пациентов акнеподобными дерматозами, сочетанные с демодекозом. Наибольшими показателями частоты встречаемости обладали клинические изоляты стафилококков основной группы, особенно в отношении липазной активности, ДНК-азы, гемолизина.

Производили изучение чувствительности к химиопрепаратам стафилококков, выделенных у больных акнеподобными дерматозами с поверхности кожи.

Результаты определения антибиотикорезистентности S. aureus и S.haemolyticus показали, что при розацеа и периоральном дерматите, сочетанных демодекозом, чувствительность к доксициклину наблюдалась у 61,8±3,9% штаммов, к эритромицину – 47,6±2,1%, к кларитромицину – 32,4±2,7% штаммов. У неинвазированных больных наблюдалось увеличение количества штаммов, чувствительных к антибактериальным препаратам. Частота встречаемости чувствительных изолятов составила 78,2±3,7%, 54,9±3,1% и 41,2±2,3% соответственно.

С целью более полной характеристики чувствительности клинических изолятов к антимикробным препаратам использовали определение минимальной ингибирующей концентрации (табл.7).

Среди S. aureus и S. haemolyticus преобладали штаммы чувствительные к доксициклину, наименьшая чувствительность наблюдалась к антибактериальному препарату кларитромицину.

Таблица 7

Антибиотикорезистентность штаммов S. aureus и

S. haemolyticus (%)

Антибактериальные препараты Чувствительные (1 группа) Умеренно- устойчивые (2 группа) Устойчивые (3 группа)
Эритромицин 34,1±1,5 42,8±2,2 23,1±1,9
Кларитромицин 27,9±2,3 32,9±3,1 39,2±1,3
Доксициклин 48,2±0,9 34,4±2,4 17,4±2,6

Наблюдается изменение чувствительности выделенных стафилококков к антибактериальным препаратам при акнеподобных дерматозах в зависимости от наличия микроскопических клещей рода Demodex. Так, S. aureus и S. haemolyticus, выделенные у больных розацеа и периоральным дерматитом без демодекоза, в основном обладают высокой и средней чувствительностью к антибиотикам, в отличие от штаммов, изолированных у инвазированных пациентов, где наблюдалось увеличение количества умеренно устойчивых изолятов.

Для характеристики этиологической значимости клинических изолятов стафилококков проводили выявление их вирулентности in vivo. Установлено, что 77,8±2,4% штаммов S. aureus и S. haemolyticus, выделенных у больных дерматозами, сочетанных демодекозом, обладали вирулентностью, в то время как у неинвазированных больных доля вирулентных штаммов уменьшалась до 46,7±1,2% (p<0,001).

Рис.2. Соотношение клинических изолятов S. aureus и S. haemolyticus

с различной вирулентностью (LD50/lg)

Наблюдалось увеличение количества бактерий со слабовирулентными (32,1%) и значительное уменьшение высоковирулентных штаммов (20,5%). Для высоко вирулентных штаммов уровень показателей LD50 (lg) составил 5,4±0,6, для умеренно вирулентных штаммов - 2,4±0,1, для слабовирулентных - 1,6±0,3 (рис. 2).

Таблица 8

Чувствительность ПЦР с системами праймеров при индикации и идентификации S. aureus и S. haemolyticus

Тест-система для индикации Чувствительность, КОЕ/мл Определяемый возбудитель
участка гена гемолизина-III 1х103 Staphylococcus haemolyticus
участка гена -гемолизина 1х103 Staphylococcus haemolyticus
участка гена липазы 1х102 Staphylococcus aureus
участка гена ДНК-азы 1х103 Staphylococcus aureus

На следующем этапе работы проводили молекулярно-генетические исследования с целью выявления нуклеотидных последовательностей генов вирулентности, детерминирующих липазу, ДНК-азу (S. aureus) и гемолизина-III, -гемолизина (S. haemolyticus). Для этого была разработана ПЦР-тест-система на основе флуоресцентной детекции продуктов амплификации с регистрацией в режиме «реального времени» и определена чувствительность ПЦР с системами праймеров при индикации и идентификации S. aureus и S. haemolyticus (табл.8).

При проведении экспериментов были получены результаты, представленные на рис. 3 (а;б).

а) к участку гена фактора ДНК-азы S. aureus

б) к участку гена -гемолизина S. haemolyticus;

Рис. 3. Кривая роста флуоресценции по каналу FAM в эксперименте

с праймерами

В ходе наших экспериментов были получены количественные показатели содержания ДНК S. haemolyticus и S. aureus. В пробах, содержащих факторы вирулентномти ДНК-азы S. aureus (рис.3а) и -гемолизин S. haemolyticus (рис.3б), наблюдалось превышение порога флуоресцентного сигнала по каналу Fam, что свидетельствует о наличии искомых нуклеотидных последовательностей в исследуемом материале.

ВЫВОДЫ

  1. Установлено, что среди больных акнеподобными дерматозами преобладали пациенты с розацеа (47,3%) и периоральным дерматитом (35,1%). Частота встречаемости микроскопических клещей рода Demodex у обследованных при данных заболеваниях составила 88,7% и 58,8% соответственно.
  2. Наиболее частыми клиническими формами акнеподобных дерматозов, у больных розацеа, осложненных демодекозом являлись пустулезная (43,7%) и папулезная (38,0%). У пациентов с периоральным дерматитом, сочетанным с демодекозом, чаще наблюдалось средней тяжести (50,0%) и тяжелое (32,7%) течение заболевания.
  3. Клиническая картина розацеа и периорального дерматита в сочетании с демодекозом имела ряд особенностей: увеличение частоты встречаемости субъективных симптомов (69,1% и 62,8% соответственно), преобладание тяжелых форм течения заболеваний (7-21баллов и 3-7 баллов соответственно) и наличие обострений более 4 раз в год (52,9% и 53,5% соответственно).
  4. У больных розацеа и периоральным дерматитом при наличии демодекоза отмечался более широкий видовой спектр микробиоценоза кожи лица (19 видов, в группе сравнения 9 видов). В микрофлоре доминировали представители рода Staphylococcus, показатели частоты встречаемости и плотности колонизации которых достоверно превышали аналогичные показатели в группе сравнения. Наиболее значимые различия выявлены у S. aureus (25,9%, 1127,04±121,25 lg КОЕ/см2; р<0,05) и S. haemolyticus (32,6%, 527,40±27,13 lg КОЕ/см2; р<0,05).
  5. Среди S. aureus и S. haemolyticus, выделенных у больных акнеподобными дерматозами, осложненными демодекозом, преобладали высоковирулентные штаммы (44,5%), в отличие от дерматозов без демодекоза, в которых наблюдалось превалирование умеренно (36,1%) и слабовирулентных (13,8%) клинических изолятов.
  6. У больных розацеа и периоральным дерматитом наблюдалось достоверное увеличение показателей частоты выявления факторов вирулентности стафилококков, выделенных с поверхности пораженных участков кожи лица – липазы (85,2±5,8; р<0,05), ДНК-азы (89,3±4,9; р<0,05) и гемолизина (93,4±3,7; р<0,05).

ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ

    1. При обследовании больных розацеа и периоральным дерматитом рекомендуется проводить паразитологическое исследование, направленное на выявление D. folliculorum, и бактериологическое обследование кожи лица для последующего назначения этиотропного лечения, включающего антипаразитарную и антибактериальную терапию.
    2. Больным розацеа и периоральным дерматитом, осложненных демодекозом, целесообразно диспансерное наблюдение с проведением паразитологического обследования не менее 4 раз в год.
    3. Для определения тяжести течения розацеа и периорального дерматита, осложненных демодекозом, рекомендуется выявлять факторы вирулентности бактерий, выделенных с поверхности пораженных участков кожи лица.

ЗАКЛЮЧЕНИЕ

Итоги. Таким образом, при сочетании розацеа и периорального дерматита с демодекозом наблюдается более тяжелое течение дерматозов с увеличением количества обострений. У больных акнеподобными дерматозами, осложненных демодкозом, отмечается широкий видовой спектр микроорганизмов кожи лица с превалированием высоковирулентных штаммов и увеличением показателей частоты выявления факторов вирулентности.

Перспективы дальнейшей разработки темы

Перспективы дальнейшей разработки темы лежат в дальнейшем микробиологическом исследовании акнеподобных дерматозов в зависимости от наличия микроскопических клещей рода Demodex, а также в разработке комплексного лечения дерматозов в сочетании с демодекозом.

Список работ, опубликованный по теме диссертации

  1. Елистратова Л.Л., Сопутствующая бактериальная микрофлора при демодекозе / Л.Л. Елистратова // Медицинский академический журнал. - 2010 – Т.10 – №5. – с. 105.
  2. Елистратова Л.Л., Эффективность лечения демодекоза препаратами нитроимидозолового ряда / Л.Л. Елистратова // Клиническая микробиология и антимикробная химиотерапия. – 2010. – Т.12 – №2. – С. 27.
  3. Елистратова Л.Л., Ассоциация клещей рода Demodex и стафилококков у больных демодекозом / Л.Л. Елистратова, Н.И. Потатуркина-Нестерова // Медицинский академический журнал. - 2010. - Т.10 – №5. – с. 85.
  4. Елистратова Л.Л., Современное состояние проблемы демодекоза / Л.Л. Елистратова, А.С. Нестеров, Н.И. Потатуркина-Нестерова // Фундаментальные исследования. - 2011. - №9. - C. 67 - 69.
  5. Елистратова Л.Л., Комплексное лечение демодекоза / Л.Л. Елистратова // Вестник РГМУ. - 2011. - № 1. - с. 188.
  6. Елистратова Л.Л., Лечение акнеподобных дерматозов, осложненных демодекозом / Л.Л. Елистратова // 12 Всемирный конгресс «Здоровье и образование в 21 веке»: Научный журнал оригинальных статей "Здоровье и образование в xxi веке". – М., 2011. – С. 489.
  7. Елистратова Л.Л., Морфология биопленки кожи лица при акнеподобных дерматозах, осложненных демодекозом / Л.Л. Елистратова, А.С. Нестеров, Н.И. Потатуркина-Нестерова // Фундаментальные исследования. - 2012.- №8. - C. 308 310.
  8. Елистратова Л.Л., Особенности клинического течения периорального дерматита, осложненного демодекозом / Л.Л. Елистратова, Н.И. Потатуркина-Нестерова // Современные проблемы науки и образования. - 2012 №6. Электронный журнал. Режим доступа:   http://www.science-education.ru/106-7359 .
  9. Елистратова Л.Л., Особенности микробиоты кожи лица при розацеа, осложненной демодекозом, в зависимости от формы розацеа / Л.Л. Елистратова // Современные исследования области естественных и технических наук: междисциплинарный поиск и интеграция. Материалы научно-практической всероссийской конференции (школы-семинара) молодых ученных. - Тольятти, 2012. – С. 138–144.
  10. Елистратова Л.Л., Особенности клинического течения розацеа при сочетании с демодекозом / Л.Л. Елистратова, А.С. Нестеров, Н.И. Потатуркина-Нестерова // Казанский медицинский журнал. - 2012 Т.93 №6 с. 899-902.
  11. Елистратова Л.Л., Особенности микрофлоры кожи лица при периоральном дерматите, сочетанном с демодекозом / Л.Л. Елистратова // Современные проблемы науки и образования. - 2013 №1. Электронный журнал. Режим доступа: http:// http://www.science-education.ru/107-7629 .
  12. Елистратова Л.Л., Особенности клинических проявлений акнеподобных дерматозов, осложненных демодекозом / Л.Л. Елистратова, А.С. Нестеров, Н.И. Потатуркина-Нестерова // Практические рекомендации. Ульяновск: УлГУ. - 2012. – 33 с.
  13. Елистратова Л.Л., Микрофлора кожи при акнеподобных дерматозах / Л.Л. Елистратова, Н.И. Потатуркина-Нестерова, А.С. Нестеров // Практические рекомендации. Ульяновск: УлГУ. - 2012. – 33с.

СПИСОК СОКРАЩЕНИЙ

АкД Д - акнеподобные дерматозы - демодекоз
АСМ - атомно-силовая микроскопия
ИТПОД - индекс тяжести периорального дерматита
КОЕ/см2 - количественное выражение содержание микробов (колониеобразующая единица)
МИК - минимальная ингибирующая концентрация
ПД - периоральный дерматит
Р - розацеа
ШДОР - шкала диагностической оценки розацеа


 


Похожие работы:

«ГАЛЯМОВА Гульмира Калелбаевна БИОГЕОХИМИЧЕСКАЯ ХАРАКТЕРИСТИКА НЕКОТОРЫХ ДРЕВЕСНЫХ КУЛЬТУР Г. УСТЬ-КАМЕНОГОРСКА 03.02.08 – Экология (биология) Автореферат диссертации на соискание ученой степени кандидата биологических наук Астрахань 2013 Работа выполнена в РГП на ПХВ Семипалатинский государственный педагогический институт ФГБОУ ВПО Астраханский государственный технический университет Научный руководитель : Панин Михайл Семенович, доктор биологических наук, профессор Научный...»

«ЛАТКИНА ЕЛЕНА ИВАНОВНА РАСПРОСТРАНЕНИЕ ОТОДЕКТОЗА СОБАК И КОШЕК В СУРГУТСКОМ РАЙОНЕ ХАНТЫ-МАНСИЙСКОГО АВТОНОМНОГО ОКРУГА И ИЗУЧЕНИЕ ЭФФЕКТИВНОСТЬ НОВЫХ ПРЕПАРАТОВ ПРИ ЭТОЙ ИНВАЗИИ 03.00.19 – паразитология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата ветеринарных наук Тюмень – 2009 Работа выполнена в Государственном научном учреждении Всероссийский научно-исследовательский институт ветеринарной энтомологии и арахнологии и в условиях клиники Сургутской...»

«Суфияров Ринат Сабитович КОМПЛЕКСНАЯ ПРОФИЛАКТИКА, ДИАГНОСТИКА И ХИРУРГИЧЕСКОЕ ЛЕЧЕНИЕ АССОЦИИРОВАННЫХ ГНОЙНО- ВОСПАЛИТЕЛЬНЫХ ПРОЦЕССОВ 14.01.17. – ХИРУРГИЯ 03.02.03- микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора медицинских наук УФА – 2011 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Башкирский государственный медицинский университет Министерства здравоохранения и социального...»

«НОВЫЕ ПОСТУПЛЕНИЯ В БИБЛИОТЕКУ МАРТ авторефераты 1. Александрова, Наталья Владимировна. Состояние системы мать-плацента-плод, течение и исходы беременности, наступившей с использованием вспомогательных репродуктивных технологий : автореферат диссертации. доктора медицинских наук : 14.01.01 / Н. В. Александрова ; конс.: О. Р. Баев, Г. Т. Сухих ; Научный центр акушерства, гинекологии и перинатологии им. В. И. Кулакова (М.). - М. : б. и., 2013. - 46 с. Экземпляры: всего:1 - анл(1).

«Низова Анастасия Валерьевна Изучение устойчивости к лекарственным препаратам первой и второй линии штаммов Mycobacterium tuberculosis, выделенных от больных с хроническим течением туберкулеза 03.00.07 – Микробиология 03.00.03 – Молекулярная биология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Москва – 2009 Работа выполнена в Федеральном государственном учреждении науки Государственный научный центр прикладной микробиологии и биотехнологии...»

«Артамонов Александр Юрьевич ЭФФЕКТЫ ДЕЙСТВИЯ ПРИРОДНЫХ АНТИМИКРОБНЫХ ПЕПТИДОВ И ИХ СИНТЕТИЧЕСКИХ АНАЛОГОВ С РАЗЛИЧНЫМИ ИЗМЕНЕНИЯМИ СТРУКТУРЫ МОЛЕКУЛЫ 14.03.03 – патологическая физиология 03.01.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2012 Работа выполнена в Отделе общей патологии и патофизиологии Федерального государственного бюджетного учреждения Научно-исследовательский институт экспериментальной медицины...»

«Жиренкина Екатерина Николаевна Особенности очага висцерального лейшманиоза в Папском районе Наманганской области Узбекистана 03.02.11 – паразитология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва – 2013 Работа выполнена в ГБОУ ВПО Первый Московский государственный медицинский университет имени И.М. Сеченова Министерства здравоохранения Российской Федерации Научный руководитель: доктор биологических наук, профессор Понировский Евгений...»

«Жадченко Юлия Викторовна Распространенность стафилококков в популяции лиц, живущих в крупном промышленном городе 03.02.03 – Микробиология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Волгоград 2013 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Волгоградский государственный медицинский университет Министерства здравоохранения Российской Федерации Научный руководитель: доктор...»

«МАРКОВА Юлия Александровна ПОЛИГОСТАЛЬНОСТЬ УСЛОВНО-ПАТОГЕННЫХ ЭНТЕРОБАКТЕРИЙ НА МОДЕЛИ ИХ ВЗАИМОДЕЙСТВИЯ С РАСТЕНИЯМИ 03.02.03-микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Иркутск – 2013 Работа выполнена в ФГБУ Научный центр проблем здоровья семьи и репродукции человека Сибирского отделения Российской академии медицинских наук ГБОУ ДПО Иркутская государственная медицинская академия последипломного образования Министерства...»

«Сабарайкина Светлана Михайловна ЭКОЛОГО-БИОЛОГИЧЕСКИЕ АСПЕКТЫ НЕКОТОРЫХ ПРЕДСТАВИТЕЛЕЙ КРАСНЫХ СМОРОДИН ПОДРОДА RIBESIA L. В УСЛОВИЯХ ЯКУТИИ 03.00.05 – ботаника 03.00.16 – экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Саратов – 2009 Работа выполнена в филиале Ботанический сад Института биологических проблем криолитозоны СО РАН. Научные руководители: доктор сельскохозяйственных наук, профессор Сорокопудов Владимир Николаевич кандидат...»

«Золотарева Наталья Владимировна Регуляция каталитической активности алкогольдегидрогеназы фармакологическими препаратами Пирацетам, Зорекс и Унитиол 03.01.04 – биохимия Автореферат диссертации на соискание ученой степени кандидата биологических наук Тверь – 2011 Работа выполнена на кафедре физико-химической экспертизы биоорганических соединений Тверского государственного университета Научный руководитель доктор химических наук, профессор Лапина Галина Петровна

«Новикова Ирина Александровна КОРРЕКЦИЯБИОХИМИЧЕСКОГО СТАТУСА У ВЫСОКОПРОДУКТИВНЫХ КОРОВ ПРИ КЕТОЗАХ В УСЛОВИЯХ ПРОМЫШЛЕННОГО КОМПЛЕКСА 03.01.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Курск – 2013 Диссертационная работа выполнена в ФГБОУ ВПО Орловский государственный аграрный университет. Научный руководитель: доктор биологических наук, доцент Ярован Наталья Ивановна Официальные оппоненты:

«МИХАЙЛОВА ЛЮДМИЛА ВИКТОРОВНА БИОЛОГИЯ УСЛОВНО-ПАТОГЕННЫХ МИКРООРГАНИЗМОВ, ВЫЗЫВАЮЩИХ КИШЕЧНЫЕ ИНФЕКЦИИ 03.02.03 – Микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских...»

«ПЕСТОВ АРТУР ЮРЬЕВИЧ ЗАКОНОМЕРНОСТИ ВЗАИМООТНОШЕНИЙ БИОЦЕНОЗА И ФИЗИКО-ХИМИЧЕСКИХ СВОЙСТВ РОТОВОЙ ЖИДКОСТИ ПРИ КАРИЕСЕ 03.02.03 – Микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Волгоград 2012 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Волгоградский государственный медицинский университет Министерства здравоохранения Российской Федерации. Научный...»

«НОВЫЕ ПОСТУПЛЕНИЯ В БИБЛИОТЕКУ Авторефераты Январь-2013 1. Аббасова, Самира Фуад кызы. Возможности видеоэндоскопического хирургического лечения хронического калькулезного холецистита у лиц пожилого возраста : автореферат диссертации. кандидата медицинских наук : 14.01.17 / С. Ф. Аббасова ; Российский университет дружбы народов (М.), кафедра госпитальной хирургии. - М. : б. и., 2013. - 19 с. Экземпляры: всего:1 - анл(1). 2.

«ШАРПАН Мария Владимировна МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ ПРОЦЕССОВ БИОЛОГИЧЕСКОЙ ДЕСТРУКЦИИ НЕФТЯНОГО ЗАГРЯЗНЕНИЯ МОРЯ 03.00.16 – Экология (физико-математические науки) Автореферат диссертации на соискание ученой степени кандидата физико-математических наук К раснодар 200 8 Работа выполнена на кафедре прикладной математики ГОУ ВПО К убанский государственный...»

«­ Краевский Сергей Владимирович АТОМНО-СИЛОВАЯ МИКРОСКОПИЯ АФФИННЫХ ВЗАИМОДЕЙСТВИЙ В МИКРОБИОЛОГИИИ 03.02.03 – микробиология 03.01.06 – биотехнология (в том числе бионанотехнологии) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Оболенск 2011 Работа выполнена в ФГУП Государственном научном центре Российской Федерации - Институте теоретической и экспериментальной физики. Научные руководители : кандидат биологических наук Игнатюк Т. Е. кандидат...»

«МИНВАЛЕЕВ Ринад Султанович ОСОБЕННОСТИ ВНУТРИСЕРДЕЧНОГО И ВНУТРИОРГАННОГО КРОВОТОКА ПРИ ИЗБРАННЫХ ПОЗАХ ЧЕЛОВЕКА (ПО ДАННЫМ ДОППЛЕРЭХОГРАФИИ) 03.00.13 - физиология человека и животных АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 1999...»

«Павлов Виталий Михайлович Методология и результаты молекулярно-генетического изучения вакцинного штамма Francisella tularensis 03.02.03– микробиология Автореферат диссертации на соискание ученой степени доктора биологических наук Оболенск – 2011 Работа выполнена в Федеральном государственном учреждении науки Государственный научный центр прикладной микробиологии и биотехнологии Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека. НАУЧНЫЙ...»

«ГАЕВСКАЯ НАТАЛЬЯ ЕВГЕНЬЕВНА ХАРАКТЕРИСТИКА БИОЛОГИЧЕСКИХ СВОЙСТВ БАКТЕРИОФАГОВ ХОЛЕРНЫХ И ПАРАГЕМОЛИТИЧЕСКИХ ВИБРИОНОВ 03.02.03 – микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Ростов-на-Дону 2013 Работа выполнена в Федеральном казённом учреждении здравоохранения Ростовский-на-Дону ордена Трудового Красного Знамени научно-исследовательский противочумный институт Федеральной службы по надзору в сфере защиты прав потребителей и...»






 
2014 www.avtoreferat.seluk.ru - «Бесплатная электронная библиотека - Авторефераты диссертаций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.